Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187561
Clone ID OST187561
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187561
Sequence
GACTGAGAGGCTGGGGAGCAGCAGCATGCAGCCGGAGGAGGGAACGGGCTGGCTGTTGGAGCTGCTGTCCGAGGTGCAGC
TACAACAGTATTTCCTGAGGCTTCGAGATGACCTCAACATTACCCCTNTNNATGANACCCNNGATGGAGTAGAGGAGTAC
CTGACAAGAATGTGACCATGGAGCCTGNACTGGGAACTNGCGGNCATTGGCCTGGCTCTTATGAACTGGTACCTATAANC
AGNCGGAAGGAGGCATCAGANNCAGAAAAGGTGNNAGGATNTTCTNTGGCAGGGACCNGGACCCAANGCCCCGNATGTNG
ANGGAGACCCNNGNGGCNCCAGGACTTNNCTGTAGGACCTGGTACTCNCGTGTTGNTANCTGATGAGNNCCCATCAGNCT
CTGTTGCCAAAGTCGTGGCCCCAGCTATGGATATCTGCTTCTTCCAGAGAAATAAAGCTTGTTTCTATTTTATGTTAAAA
AATGG
Sequence Type mRNA
Unitrap ID UNI21339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32663823..32683579 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022791 (Tnk2) NM_016788 tyrosine kinase, non-receptor, 2 Gene [Source:MGI (curated);Acc:Tnk2-002]

 
Come back to gene ENSMUSG00000022791


For any suggestions or comments, please send an email to unitrap@crg.es