Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187499
Clone ID OST187499
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187499
Sequence
ACTGAGGACCTTCTTTTGNTAGACGTGCTANCAGAGTGAGAAGGCATAAATGAGGGTAGCNGGAGCCTGCAAAGTTGGTA
CGTGGCCGTGGCAGTATTCTTACTGACCTTCTATGTTATTTCTCAAGTATTTGAAATTAAAATGGATGCAAGTTTAGGAA
ATCTATTTGNTNNNTCCCNCNCCCGTCNNANACCTTTATTCCTNCTANNNCTNGCTAGGTNCATNTGAGGCATCACTNTA
GNCGTNCCCGGAGAAGCATNGTGCTTTGACNATGGCTTGNGGAGCAGCCAATGTCGTGGGACCCAAGATCTGCCTGGAGG
ACAATGNTTNGATGAGNGGTGNGAAGAATAATGTCGGAAGAGGANTCAATATTGCCTTGGTAAATGGGAAAACAGGGGAA
GTAATAGACACCAAA
Sequence Type mRNA
Unitrap ID UNI10553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22271351..22293321 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029672 (D6Wsu176e) NM_138587 Protein FAM3C Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q91VU0]

 
Come back to gene ENSMUSG00000029672


For any suggestions or comments, please send an email to unitrap@crg.es