Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187454
Clone ID OST187454
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187454
Sequence
GACTGAGGTTGGCACCCATGCGGCTCTCACGCCTCTCCAAGCGCCACTTCGTCCCTGTGTTTGTTGTCTTCTTCNTCTGT
TTCGGACTGACCGTCTTCGTCGGCATCGAGGGACCCAGAGTGATCGAGACTTTGCCTGCTAATTATTCACTCAATAGTAG
CAAAAAGCTAAAGACAGTTATACCTTCAAACCCACTGTCCACATATAACCAACAACTATGGCTGACGTGCGTTGTGGAGC
TGGAGCCCTCAGAAGAAACATCCATCCAAACCAGCTTCACCATGACAGTGAAGGTCGATGGTGTGTCTCAAGATGGAACC
ACGACGTACATCCATAACAAGGTTCACAACCGGACGAGGACCCTCACGTGTGCAGGGAAGCCATCAACTCTGCCGGGCAG
TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCAGATTTCTGAGTCCGAGGACAGCCTGGTCTACA
GAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTAGAAAGACCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6454992..6844510 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079733 (AC183095.3-201)  

 
Come back to gene ENSMUSG00000079733


For any suggestions or comments, please send an email to unitrap@crg.es