Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187430
Clone ID OST187430
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187430
Sequence
GACTGAGCTTGCTTCCCAGAGCCCTGCCTTGTCTCAAAGAGAAGAGAACAATGACCAAGTTACAGGTCCTGGTGCT
Sequence Type mRNA
Unitrap ID UNI25335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 24920275..24920336 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047603 (Zfp235) NM_019941 zinc finger protein 235 Gene [Source:MGI Symbol;Acc:MGI:1929117]

 
Come back to gene ENSMUSG00000047603


For any suggestions or comments, please send an email to unitrap@crg.es