Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA343
Clone ID RHA343
Vector pGT0Lxf
Project baygenomics

Sequence tag RHA343
Sequence
ACGCCATGTTTACAGGTGAGATGAGCGAGAGCCGAGCAAAGAGAGTTCGAATAAAGGAGGTGGACGGCTGGACCCTGAGG
ATGCTGGTCGATTACGTTTACACGGCAGAGATTCAGGTCACAGAGGAGAACGTGCAGGTCCTCCTCCCAGCAGCTGGCCT
GCTACAGTTACAGGATGTGAAGAAGACATGCTGTGAATTTTTAGAATCCCAGCTTCACCCTGTCAACTGCTTAGGAATCC
GGGCTTTTGCTGATATGCATGCATGCACAGACCTCCTGAATAAGGCCAACACGTATGCAGGTCCCAGGTCAAGAG
Sequence Type mRNA
Unitrap ID UNI6659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67258494..67346905 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031605 (Klhl2) NP_848748 kelch-like 2, Mayven (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924363]

 
Come back to gene ENSMUSG00000031605


For any suggestions or comments, please send an email to unitrap@crg.es