Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187411
Clone ID OST187411
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187411
Sequence
GACTGAGGGTTCCTCCATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGNNGTCTGGTGCCATN
TACCTTTCNTAGGAAGAGAAGTCNTTTNTATTCAGGAGTTCTGCAGAGNTACATGTCCTCCAAAGCACCTTCTTTGTCTT
GTCATAATAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATTCAA
GAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTGAGATGTGGAGATT
GCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGA
AGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCC
AGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATT
Sequence Type mRNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56034852..56035406 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]

 
Come back to gene ENSMUSG00000044763


For any suggestions or comments, please send an email to unitrap@crg.es