Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0487
Clone ID DD0487
Vector pGT1lxrT2
Project sanger

Sequence tag DD0487
Sequence
GCGTCACCCGTGACTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAG
AGGTGCTGAAGACCGCCCTCATCCACGATGGCCTAGCACGTGGCATACGCGAAGCTGCCAAAGCCTTAGACAA
Sequence Type mRNA
Unitrap ID UNI576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23506570..23506835 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]

 
Come back to gene ENSMUSG00000061983


For any suggestions or comments, please send an email to unitrap@crg.es