Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187116
Clone ID OST187116
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187116
Sequence
TCCCTTTGACCTAGAGGGGGANCCCTACAAAGAGGAGATGANATCGAANTCCAGANGCCAAATGAGGTGTCCTCACCTTC
CCACCACCTTCTGCAGCCATTCCTCCAGCAGCAGAAGCCCAGCCTTTGGCGGCCCAGCCCAGAGTGTCCACCGTCCAGCA
GTGTCANANTCCTACCAACTATTTGCAAGGCCTGAACGGGAAGCCCATCATTGCAGCGCCAGTGTTTACGAANATGCTGC
ANAACTTGTCAGCCTCTGAGGGGCAGNTGGTTGTCTTTGAGTGCAGAGTGAAAGGGGCCCCATCTCCNAAAGTCGAGTGG
TACAGAGAAGGGACATTAATAAAAGACTCTCCCGACTTCAGGATCTTACAGAA
Sequence Type mRNA
Unitrap ID UNI22468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62615545..62626370 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es