Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA219
Clone ID HMA219
Vector pGT0Lxf
Project baygenomics

Sequence tag HMA219
Sequence
CTGAGGAGGGCTCAGGCAGAGGGTCGAAGCGAGCGGCGCTCGCGACAGACTGCGCTCCGCGATGGTGGGCGTCCCTGGAG
CGGCCGCCTTCCAAC
Sequence Type mRNA
Unitrap ID UNI5148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262278..154262372 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60622660..60622754 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070791 (AC140317.2)  

 
Come back to gene ENSMUSG00000070791


For any suggestions or comments, please send an email to unitrap@crg.es