Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187062
Clone ID OST187062
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187062
Sequence
ACAATCAAGATGGTACATGCTGAAGCCTTTTCTCGTCCNTTGAGTCGGAATGAAGTTGTCGGTTTAATTTTCCGTTTAAC
AATATTTGGTGCAGTAACGTACTTCACTATTAAATGGATGGTAGATGCCATTGACCCCACCAGGAAGCAGAAGGTAGAAG
CTCAGAAACAGGCCGGAAAAACTGATGAAGCAAATTGGTGTGAAAAATGTGAAGCTTTCAGAATATGAAATGAGTATTGC
TGCTCATCTAGTAGACCCTCTTAATATGCATGTTACTTGGAGTGATATAGCAGGTTTAGATGACGTCATTACAGATCTGA
AAGACACAGTCATCTTACCTATCAAAAAGAAGCATTTGTTTGAGAATTCCAGACTACTGCAGCCTCC
Sequence Type mRNA
Unitrap ID UNI15835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32776015..32781495 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013662 (Atad1) NM_026487 ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

 
Come back to gene ENSMUSG00000013662


For any suggestions or comments, please send an email to unitrap@crg.es