Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST186854
Clone ID OST186854
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST186854
Sequence
GACTGAGTTGGAAACAGACAACTGGCTTTTCCCCAAGAGCCCCAGTCCGCTGAGCCCGAGCCCCATCCCCAGTCCTAACG
TGAAACTTGAGAATTCCACTCTCCTGACAGTGGAGCCCTCACCGCTGGACAAGAACAAGTGCTTCTTCGTGGACGAGTCA
GAGCCCCTTCTGCGTTGCGACTTCCACATCCAGTGGCTCTTCAGCACGTGAGCAGAAACGGCTCCTTTATTACCAAAGAA
ANNAAGGACACAGNGTTGTGGNAGGNACACCTGGACCCCTGTGACTTGNAGCCCATNTTTGATGACNTGCTGCNTATNCT
GANCCCNNANGAGCTGCGGGTGATTGAAGAGATTCCCCAGGCCTGAGGACAAACTGGACCGCCTCTTCGANATNATTGGG
GGTCAAGAGCCAAGAAGCCAGCCAGACCCTCTTGGACTCTGTGTACAGTCATNTTCCTGACCTATTGTANAACACAGGGG
CACTGCATTCTGGGAATCAACCTACTGGCGGGGTGATTTCATTTCGCTTCTGCTT
Sequence Type mRNA
Unitrap ID UNI16411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43222283..43224983 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]

 
Come back to gene ENSMUSG00000023915


For any suggestions or comments, please send an email to unitrap@crg.es