Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC020
Clone ID BGC020
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC020
Sequence
TGCACAGTTTCCTAAACAGCATCAGCAGTCTCCTAAGCAGCAGTTACAGCAAGTACAACAACAGACACAGCAGCCAGTGG
CCCAGCCTTCTTCAGTGTCTCAGCAGCAGCAGCCTCAGCAGTCAGCATTGCCGCCTGGTATCAAACCTACCATCCAGATC
AAACAGGAGT
Sequence Type mRNA
Unitrap ID UNI6041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105774979..105775148 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035401 (2210018M11Rik) NM_172280 RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

 
Come back to gene ENSMUSG00000035401


For any suggestions or comments, please send an email to unitrap@crg.es