Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC132
Clone ID BGC132
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC132
Sequence
ATTAATAAAAGCATCAGGCACCAAGGAAATTTGTGTGGTTCGCTTCACACCAGTAACTGAAGAAGATCAGATTTCTTACA
CTTTGCTGTTTGCGTACTTCAGTAGCAGAAAGCGCTATGGTGTGGCTGCTAACAACATGAAGCAGGTTAAAGACATGTAC
CTCATTCCATTGGGCGCTGCAGATAAAATCCCACACGCCTCTTGTGCCTTTTGATGGACCTGGTCCCAGGTC
Sequence Type mRNA
Unitrap ID UNI6677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30863012..30865589 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es