Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST186527
Clone ID OST186527
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST186527
Sequence
GACTGAGAGGACCTTGGTTACCTGCAGCAATGGCTGAAGGCCTTTGTGGGTGTCTTCGAGAAGACTATCTCGTTATCCTC
CCTGGAACCTCGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25366

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110547135..110547221 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056724 (Nbeal2) neurobeachin-like 2 Gene [Source:MGI Symbol;Acc:MGI:2448554]

 
Come back to gene ENSMUSG00000056724


For any suggestions or comments, please send an email to unitrap@crg.es