Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC187
Clone ID BGC187
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC187
Sequence
AGAAGCAAGACCTGGAGGTGGCCGTCAAATGCATTAACAAGAAGAACCTTGCCAAGTCCCAAACACTGCTGGGAAAGGAA
ATCAAAATCCTGAAGGAACTAAAGC
Sequence Type mRNA
Unitrap ID UNI6681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111238145..111238240 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]

 
Come back to gene ENSMUSG00000029512


For any suggestions or comments, please send an email to unitrap@crg.es