Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0442
Clone ID DD0442
Vector pGT1lxrT2
Project sanger

Sequence tag DD0442
Sequence
CGTGGCTCTTTCTTTTCAGTACTGCTATTCGATGGTCCTCACCTTTTAGGAGCCCGCGCCTCGGTTCCAGCGGACGCTTC
CCCAGATCTCGGCTCTACCACCATCCACTGCCGTCTTACCGCCCACCATGGCCCTCTTGCACTCCAGCCGCATCCTCTCC
GGGATGGCTGCTGCCTTTCACCCAGGCCTAGCTGCTGCAGCCTCTGCCAGAGCCAG
Sequence Type mRNA
Unitrap ID UNI646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98412117..98412298 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031672 (Got2) NM_010325 glutamate oxaloacetate transaminase 2, mitochondrial Gene [Source:MGI (curated);Acc:Got2-001]

 
Come back to gene ENSMUSG00000031672


For any suggestions or comments, please send an email to unitrap@crg.es