Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST186008
Clone ID OST186008
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST186008
Sequence
AGACTGAGGCCCTACTGTGGNCATGAGTCGGTAATGCCCACTGAGGACTTCTGGGAGCCATGTCAGACGAATCCGCCTCA
GGGAGCGATCCAGACCTGGACCCGGACGTGGAGCTGGAGGATGAGGAAGAGGAGGAGGAGGAGGAGGAGGTGGCAGTGGA
GGAGCATGACAGGGATGACCGAGGAAGGCCTGCTGGATGACACATCCCTGGAAGGCATGTGTGGCACTGAGCATGCCCAG
CTGGGGGAAGATGGGCAGCGGCCGCCGCGGTGCACTTCAACTACCTCATCTCAGTCTGAGCCTTCAGAGCAGCTTAGGCA
CCAAGGCAAGATCCTAGCATNCGAGGACCCCAAAAANAANCGAGCTCAGAAGCCCTNTCNCATGAGAAGAAACATACTAC
ATG
Sequence Type mRNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106625048..106656474 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es