Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST185987
Clone ID OST185987
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST185987
Sequence
GACTGAGTCCCCCGAGGCTTCCCCAGTCCCGGGGTCTCTGTGCCGGGACGCTGCTATGGACGACATTTTCACTCAGTGCC
GGGAGGGCAACGCGGTGGCGGTGCGCTTGTGGCTGGACAACACAGAGAACGACCTCAATCAGGGGGATGATCATGGCTTC
TCCCCCTTGCACATGGGCCTGCCGAGAAGGCCTGCTCTGCGGTGGTTGAAATGCTGATCATGCGTGGAGCACGGATTAAT
GTGATGAATCGTGGGGATGATACCCCCCTGCACCTGGCAGCTAGTCATGGACACCGTGACATTGTACAGAAGCTGTTGCA
ATACAAGGCTGACATCAATGCAGNGAATGAGCACGGCAATGTGCCACTTCACTATGCATGTTTCTGGGGCCAAGACCAGG
TGGCAGAGGACCTGGTGGCTAACGGGGCTCTTGGGAGCATCTGTAACAAGCATGGAGAGATGCCTGTGGACAAAGCCAAG
GCACCCCTTAAAGAGCTTCTCCGANAACGGGCANANAAAATGGGCCAAANTCTCAACCGTATTCCATACAAGGACACATT
Sequence Type mRNA
Unitrap ID UNI25181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 112885610..112889528 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030890 (Ilk) NP_034692 integrin linked kinase Gene [Source:MGI (curated);Acc:Ilk-001]

 
Come back to gene ENSMUSG00000030890


For any suggestions or comments, please send an email to unitrap@crg.es