Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC468
Clone ID BGC468
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC468
Sequence
CATTTCTCCTCAGCCACGCCGAGGCTTTTTGTGGAGCCCCGCAATCTGTGTGGACGCCAGGACCACCGAAGGGACGATGA
TGCTGGGAGCAGAAGGCGGAGAGGGCTTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCCTGCTCCGCGGATGAAGTGCAG
CGCTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTACACCAGAGAAGGCAGACCAAGTGG
CGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCCTTGAAAAAAGACAGAGAAACTATGGGACACAGAT
ATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGGATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACAGCC
AATGATGGCTTTGTACGGCTTAGAGGACTCCCTTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGTCCC
Sequence Type mRNA
Unitrap ID UNI6697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50191269..50193468 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007850 (Hnrph1) NM_021510 heterogeneous nuclear ribonucleoprotein H1 Gene [Source:MGI (curated);Acc:Hnrph1-005]

 
Come back to gene ENSMUSG00000007850


For any suggestions or comments, please send an email to unitrap@crg.es