Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST185705
Clone ID OST185705
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST185705
Sequence
CTAACCTTACATGGCCGACCAGAGGCAGCGCTCACNTNTNTCTTNCGGGGAGGCNNTCTACCCGGTTCTTGGACTGGACA
NGANNGCAACCTCAGNNGACATTAAAAAGTCCTATCGGAAGCTGGCCCTGAAGTATCACCCTNACAAGAACCCTGATAAC
CCANAGGCGTGCAAACAAGTTTAAGGANATTAACAACGCACACNCCATCCTGACAGACGCCACGAAAAGAAACATTTATG
ACAAGTATGGCTCGCTGGGGCTCTATGTGGCGGANCAGNTTGGGGAGGAGAACGTNAACACCTACTTCGTACTCTCCAGC
TGGTGGGCCAAGGCGCTGTTTGTTGTTTGNGGCCTCCTCACCTGCTGCTACTGCTGCTGCTGTTTGTGCTGTTGCTTTAA
CTGCTGCTGTGGGAAATGCAAGCCCAAGGCACCTGAGGGGTGAGGAGACAGAATTCTACGTATCCCCTGAAGACTTGGAG
GCACAGTTGCAGT
Sequence Type mRNA
Unitrap ID UNI25389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181281077..181283534 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es