Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC481
Clone ID BGC481
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC481
Sequence
CTGTCACATGACACGTTTCCTGTCAAGATGGCGGATAATCTCCCTTCGGACTTTGATGTGATCGTAATAGGGACGGGTCT
GCCTGAATCCATCATTGCAGCTGCATGTTCAAGGAGTGGCCAGAGGGTTCTGCATGTTGATT
Sequence Type mRNA
Unitrap ID UNI6699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110273114..110299123 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025531 (Chm) NM_018818 choroidermia Gene [Source:MGI (curated);Acc:Chm-001]

 
Come back to gene ENSMUSG00000025531


For any suggestions or comments, please send an email to unitrap@crg.es