Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGC520
Clone ID BGC520
Vector pGT0Lxf
Project baygenomics

Sequence tag BGC520
Sequence
ATCGAGGAGCAACAAGACCCTACGGGCCAAATACTGGAAATAAAATATGCCAGTTCAAACTGGTCCTTCTAGGAGAGTCT
GCTGTTGGCAAATCAAGCCTGGTTCTTCGCTTTGTGAAAGGCCAATTTCATGACTTTCAAGAGAGTACCATTGGG
Sequence Type mRNA
Unitrap ID UNI6704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53623245..53623399 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017831 (Rab5a) NM_025887 RAB5A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105926]

 
Come back to gene ENSMUSG00000017831


For any suggestions or comments, please send an email to unitrap@crg.es