Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST185345
Clone ID OST185345
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST185345
Sequence
TGTGGACACCTGGTCCTTTGCTCCTGTGNAACTGAGTNCGTGAACATCATTTGTGCTGGGTCTGNGTNGNNNGAATGACN
GACCCTAAGGAATCAAATAACCTTCNNACCTCCAGGAGGATCCTGAAAACCAAAACCATCTTGAAGAACAAAATTCACAG
TGCAATATCGAAGAAGGCACAAGCAGATAACTTTGAGATACTGACCCCAGGTGGGAGCCCTGCCCCCCACCCCGTGCAGG
GAGAGGGTGGGGGTGGNAGCAGGGTCCTCTTGTCAGCCCAGGCACACTTCTGGGATCAGTAGTAGAGCAGCACTGGTCTA
CTGGGGTAGGTGGTCAGTGGCCGTTGAAGTCCTGTGGAGAGGGCTTAAGTAACCGGGGGAAGGAGTAAGGGTGATACCTA
TGGCCATGTGACCTTTGCCAGGGCGATCATGTGACCAACCATCAAGGTTGGGC
Sequence Type mRNA
Unitrap ID UNI25402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57015612..57016056 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es