Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST185175
Clone ID OST185175
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST185175
Sequence
AACTGAGGCAGTCGCAGTGGTACAGAATGGCCGACCTCAGTCTTGTGGATGCGTTGACAGAACCACCTCCAGAAATTGAG
GGAGAAATAAAGCGAGACTTCATGGCTGCGCTGGAGGCAGAGCCCTATGATGACATCGTGGGAGAAACTGTGGAGAAAAC
TGAGTTTATTCCTCTCCTGGATGGTGATGAGAAAACCGGGAACTCAGAGTCCAAAAAGAAACCCTGCTTAGACACTAGCC
AGGTTGAAGGTATCCCATCTTCTAAACCAACACTCCTAGCCAATGGTGATCATGGAATGGAGGGGAATAACACTGCAGGG
TCTCCAACTGACTTCCTTGAAGAGAGAGTGGACTATCCGGATTATCAGAGCAGCCAGAACTGGCCAGAAGATGCAAGCTT
TTGTTTCCAGCCTCAGCAAGTGTTAGATACTGACCAGGCTGAGCCCTTTAACGAGCACCGTGATGATGGTTTGGCAGATC
TGCTCTTTGTCTCCAGTGGACCCACGAACGCTTCTGCATTTACAGAGCGAGACAATCCTTCAGAAG
Sequence Type mRNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109881352..109930287 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es