Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA423
Clone ID HMA423
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA423
Sequence
CAGTAGATGATAAAGGGTTCAAAGACACCAGTCAGTATGTTGTAGGGGAATTGGCAGCACTGGAGAATGAGCAGAAGCAA
ATTGACACCCGTGCCGCGCTGGTGGAGAAGGGCCTCCGTTATCTCATGGACACAGGTCCCA
Sequence Type mRNA
Unitrap ID UNI6709

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21953433..21953558 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042302 (Ehbp1) NM_153078 EH domain binding protein 1 Gene [Source:MGI (curated);Acc:Ehbp1-001]

 
Come back to gene ENSMUSG00000042302


For any suggestions or comments, please send an email to unitrap@crg.es