Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST184975
Clone ID OST184975
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST184975
Sequence
CCCTTGTTTGCCTGGAGCAATGGAGAAAAAGTAAATATAATCAATGTCGCTAACAAGGGACTACTGCACTCCTTCGACCT
CCCAAAAGCAGTTTGCCTTGAATTCTCACCAAATAACACTGTCCTGGCAACGTGGCAGCCTTACACTACTTCTAAAGATG
GCACTGCTGGGACGCCTAACCTACAACTTTATGACATGAAAACTGGAGCATGTTTGAAATCGTTCATCCAGAAAAAAATG
CAAAATTGGTGNCCTTCCTGNTCAGANGATGAAATTATTTGTGCCCGGAATGTTAACAACGAAGTTCACTTCTTTGAGAA
CAACAATTTTAGTATGAAAAAAACTTTGTAAATAATCTTATTATCTACTT
Sequence Type mRNA
Unitrap ID UNI8460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58341505..58345677 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es