Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA113
Clone ID HMA113
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA113
Sequence
GGTTGTGAGCTCTTCTAGATGGTGATGAGAAAACCCGGGAACTCAGAGTCCAAAAAGAAACCCTGCTTAGACACTAGCCA
GGTTGA
Sequence Type mRNA
Unitrap ID UNI6321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109881518..109881593 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es