Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST184799
Clone ID OST184799
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST184799
Sequence
GACTGAGATATTAATAAGGCAGCGGAAAGAAGAAATATGAATACGGCTCCATCAAGACCCAGCCCCACACGAAGGNATCN
TTATANCTTTGGAGATAGTNGCTGAGACANGGCGGNGATCGTTCTNCAATGTCTGAGGAAGTCCACAGGAGAGAACNNAG
GGATGGCNNAAATGGCCGGNATGCCCGNGATAGCNGAGACNTTCCAGATCCTNNGGATTTGCGGGACCGNAAAGNCANCN
AGGACNTTNGGTATCACAGAGACAGCAGANGTGTNCGNNAAGCCNGGGACCTGAGGGATTTTCGGGACTTTCGTGATCTA
AGAGACTCTAGGAGATTTTCTGAGATCNTCGAGACCCTGTGTATGACAGATAC
Sequence Type mRNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164838371..164848714 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es