Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST184713
Clone ID OST184713
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST184713
Sequence
AACTGAGGGACTGTGCAGGATTTGATCGGGTAGACCTCCCTTGCTTGCTGCTCCCAGCTGCCTGGTCTTGAATACCATCA
TGGCCAAACCTTACGAATTTAACTGGCAGAAGGAAGTGCCCTCTTTCTTGCAAGAAGGAGCAGTTTTTGACAGATACTGA
AGAGGAATCTTTTGTGTTTGAGCCCAACTGCCTCTTCAAAGTAGATGAATTCNGGCTTCTTCCTGACGTGGAAGAGTGAA
GGCAAGGAAGGACAAGTGCTAGAATGTTCCCTCATCAACAGTATTCGCCAAGCAGCCATACCAAAGGATCCCAAAATCCT
GGCTGCTCTCGAAGCTGTTGGAAAATCTGAAAATGATCTGGAAGGGCGGATATTGTGTGTCTGCAGCGGCACGGATCTGG
TGAATATCGGCTTCACTTACATGGTGGCTGAAAATCCAGAAGTAACTAAGGAATGCTGAACCCACTGGGTGGTACCTTCC
CTGAG
Sequence Type mRNA
Unitrap ID UNI16552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135631283..135746447 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es