Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST184531
Clone ID OST184531
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST184531
Sequence
GACTTGAGGGTTTATNATGNNGCTTTCCAGCCCCACCGTGTTGATGNCGGCCTGGTAGCTTTCAGCATATTTCTATCNGC
TCAGNAGNCAGGACCCATAGTCNGNGTNTGTCATTTNCTGANGNAGACCNTNGGCCTCGTGCCGANGACTANAGGNNCNC
CGNNCNTGCAGNGNCNANCNCGNNNCGCNTTCGTGCNNNGTGCGCNCNNTGCCTCTTTCCNCTGGCCCCGGANGGTTCCC
NGANGCTTGACCATCATAGGGGAAGANGACCTGCCTCCTGGGGGAAGTGGATCAAGAGCTGATTGAAGACGGGCAGTGGG
AGGAGATCCTGAAGCAGCCGTGCCCCTCGCAGTACAGTGCTATCAAGGAGGAAGACCTTGTGGTTTGGGTTGACCCCTTA
GATGGCACCAAGGAGTACACTGAAGGNCTTCTTGACAATGNAACAGNTCTCATTGGGATTGCTTATGAAGGAAAGGCCAT
CGCAGGCATCATCAACCA
Sequence Type mRNA
Unitrap ID UNI16268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 187161979..187172695 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026617 (Bpnt1) NM_011794 bisphosphate 3'-nucleotidase 1 Gene [Source:MGI (curated);Acc:Bpnt1-001]

 
Come back to gene ENSMUSG00000026617


For any suggestions or comments, please send an email to unitrap@crg.es