Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA202
Clone ID RHA202
Vector pGT0pfs
Project baygenomics

Sequence tag RHA202
Sequence
CATGAACCCCGACACCGTGCTGCGAGTGGGAGGAGCAGGAAACAAGATTATCCAGCTGATCGAAGGCAAAGCTTCTGCTT
Sequence Type mRNA
Unitrap ID UNI6727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 187176213..187177869 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026617 (Bpnt1) NM_011794 bisphosphate 3'-nucleotidase 1 Gene [Source:MGI (curated);Acc:Bpnt1-001]

 
Come back to gene ENSMUSG00000026617


For any suggestions or comments, please send an email to unitrap@crg.es