Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA205
Clone ID RHA205
Vector pGT0pfs
Project baygenomics

Sequence tag RHA205
Sequence
GTCCAAAAAAAGGGAAGTATACGATAAAGGAGGGGAGCAGGCGATTAAAGAGGGCGGTGCAGGTGGTGGTTTTGGCTCAG
CCCATGGATATCTTTGATATGTTCTTTGGAGGAGGAGGAAGAATGCAAAGAGAAAGGAG
Sequence Type mRNA
Unitrap ID UNI6729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40671045..40671181 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028410 (Dnaja1) NM_008298 DnaJ (Hsp40) homolog, subfamily A, member 1 Gene [Source:MGI (curated);Acc:Dnaja1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 40189624..40189760 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043462 (AC144779.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148076957..148077093 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083396 (AC107815.11)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 109276334..109276470 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083392 (AC021631.6)  

 
Come back to gene ENSMUSG00000083392


For any suggestions or comments, please send an email to unitrap@crg.es