Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA231
Clone ID RHA231
Vector pGT0pfs
Project baygenomics

Sequence tag RHA231
Sequence
TGAGAGGAAGTCTGAAGAAGAATGGCCAGCTATAATTCTCAAGACATGGTCTGTGGGTCAGTGACATTTAGGGATGTGGC
TGTTGACTTCTCTCAGGAGGAGTGGGCCTGCCTGGATGCTACTCAGAAGGTCTTATACAGGGACATGATGTTGGAGACCT
ACAGCAACCTGGTCGCAGTGGTGGGACGTTGCATTTCCAAGCCAGATCTGATCGTCTTACTAGAGCAGGAGAAAGAGCCC
TGGATGGCTGTGAAGGAAGAAACAGACAGGCCGAGC
Sequence Type mRNA
Unitrap ID UNI6741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28756646..28759824 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063047 (Zfp780b) NM_001081021 zinc finger protein 780B Gene [Source:MGI Symbol;Acc:MGI:2444764]

 
Come back to gene ENSMUSG00000063047


For any suggestions or comments, please send an email to unitrap@crg.es