Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA485
Clone ID HMA485
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA485
Sequence
GGCTCCCATGGTGCGGTGTGGGATGCTCCTGGCTCGGCGACTAGACGCGTCTCGCCTTTGCCTCGCAGGTAAAAGATGCC
TGCTTTATACAGCGTACGTGGACAGCCACCAGTGGGAAGCCAGAGAGAAGGAGGAATACCATCTGGGTCCCAGGTCAAGG
G
Sequence Type mRNA
Unitrap ID UNI3596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100114763..100118366 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es