Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA500
Clone ID HMA500
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA500
Sequence
GACACACAGTCCCTGCCATGGCGCTCAGCGAGCCTATCTTGCCGTCCTTTGCCACTTTCGCCAGCCCGTGCGAGCGCGGC
CTCCAGG
Sequence Type mRNA
Unitrap ID UNI6747

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74842961..74843046 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055148 (Klf2) NM_008452 Kruppel-like factor 2 (lung) Gene [Source:MGI (curated);Acc:Klf2-001]

 
Come back to gene ENSMUSG00000055148


For any suggestions or comments, please send an email to unitrap@crg.es