Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0594
Clone ID DC0594
Vector pGT1lxr
Project sanger

Sequence tag DC0594
Sequence
CCTCGTCCACTAACCTCTGATTATTCTTTATCTCCTATTCTTCTTTTTACTCATGCCCATTCCCTCCTCCCCATTGTCCT
TCTCCGCGGCCAAGGCGCGGAGCTGCTCCGGCTCGGCCCGCGGGGGAGCCCGGGGAGCCGCACGTGTCCTGGGTCATGAA
ACTTAGTCCACAACAAGCTCCATTATATGGCGATTGTGTTGTTACAGTATTGCTTGCTGAAGAGGACAAAGTTGAAGATG
ATGCTATTTTTTACTTGATATTTTCTGGCTCTACCCTCTATCACTGCACAAGTACCCGGAAAGTCAGTTCTGATACGTTG
GAGACAATTGCTCCTG
Sequence Type mRNA
Unitrap ID UNI654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82600560..82714917 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]

 
Come back to gene ENSMUSG00000078669


For any suggestions or comments, please send an email to unitrap@crg.es