Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA065
Clone ID HMA065
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA065
Sequence
GGTATTAACCAGCTCCCCAGCGTCATCCAGGCTCTGGAGAAATACGA
Sequence Type mRNA
Unitrap ID UNI5181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88088433..88088479 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es