Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST183315
Clone ID OST183315
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST183315
Sequence
ACCAGAAGTACAATTTCTTCACATTTCTTCCTGGGGNGNTGTTCANCCNGTNCAGATACTTCTTCAACATTCTACTTCCT
GCTTATCTGCCTGCATCGCAGTTCGTCCCAGAGATGAGGCTTGGNGCCCTGTACACCTACTGCAGTTCCTCTGGACTTCG
TGCTGTTTGTCACCATCATCCGTGAGGCANTAAAGNAGANCCNATGNTATGTNCGTGACANNGNTATGANCTCCCAGGCN
TACATCCGACTCACGTCNCGAGGNACCGTNAAGGTGAAGAGTTTTAAACATCCAGGNGGGANACCTCATCCTTGGGGAAA
A
Sequence Type mRNA
Unitrap ID UNI25456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168516467..168536366 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es