Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA164
Clone ID HMA164
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA164
Sequence
CCGGCCAGCGGGAGCCCGCGTACCAGCTCAACATCCATGACATCAAACTGCTCTTCCTGCGCTTCGCCATGGAGCAGTCT
TTCAGTGCAGACACC
Sequence Type mRNA
Unitrap ID UNI6753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 139036583..139036677 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es