Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA172
Clone ID HMA172
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA172
Sequence
CCCAACCCGTTATGACCCCACAAGGGCCAGCAGCGCTATCAGTTCTGGTCCCAG
Sequence Type mRNA
Unitrap ID UNI639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35291735..35291783 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

 
Come back to gene ENSMUSG00000024393


For any suggestions or comments, please send an email to unitrap@crg.es