Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST183109
Clone ID OST183109
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST183109
Sequence
TCTGGCTGTGGAGGAGGAAGTGGCTCAGAGCCTTCTTGAACTGAAAGAATGTACGCGCCAGGGGGACACCGAGCTGCAGC
AGCTGGAGGTGGAGCTCCAGAGGACCAGCAAGGAGGACACCTGTGTGCAGGCTAGGCTACTGTCAGCTCATCACAGAGCT
GCAGGAGCTCAGGGAGATGGAGGAAGAGCTCCAGCTCCAGGAGAGGGATGTAGATGAGGACAACACCGTCACCATCCCCT
CTGCAGTGTATGTGGCTCATCTCTATCACCAAATTAGTAAAATACAGTGGGATTATGAATGCGAGCCAGGGATGATCAAG
GGCATCCACCACGGCCCCACAGTGGCCCAGCCCATCCACTTGGACAGTGCACAGCTCTCGCCGAAGTTCATCAGTGACTA
CCTCTGGAGCCTGGTGGACACCACGTGGGAGCCAGAGCCTTGACCTCATACCTTGCACAGAACTGGGGTTGAGGGAGCCA
AGGAGGGGATCACTCTAAAATTAAATGTCTGTATGTGAAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI3402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21560546..21562269 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074476 (Spc24) NM_026282 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914879]

 
Come back to gene ENSMUSG00000074476


For any suggestions or comments, please send an email to unitrap@crg.es