Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA322
Clone ID HMA322
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA322
Sequence
GGGACCTCATTGAAATCACTGATGCCTAGAAGCGGGAGGCTCTGTA
Sequence Type mRNA
Unitrap ID UNI6760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124909866..124909911 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es