Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone HMA348
Clone ID HMA348
Vector pGT1Lxf
Project baygenomics

Sequence tag HMA348
Sequence
AACTTACAAGCAGCGATTGGCGCCTATTATGACTTCGAGAGCCCAAATATCAGTGTGCCCTCCATGTCCTTTGTTGAAGA
TGTCACCATAGGAGAAGGGGAGTCAATACCCCCTGATACCCAGTTCATAAAAACTTGGCGGATACAGAATTCT
Sequence Type mRNA
Unitrap ID UNI6766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27930855..27931007 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es