Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST182648
Clone ID OST182648
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST182648
Sequence
GACTGAGAGGACTGATTATAGTGAGTAAGTAACCTCAGCTACATCATCTGAGCCCGTCCCTAACAGCTGACTGCCAACAC
CGTATTTACAGATCCGAACATNTCACGCTGCCCCCGGGGAACTGTGGGTTCNAGCACTCCGGGCCCACCTCGAAGGACTG
GGCCCTTCAGTTTACACATCAGACCAAAAAGCAACCTCGCAGAATGAAACGGGNAAGATCTACACTCTATGAAGTACTGT
GGAGCTTTACCTGGTGGCTGATTATGCAGAGGTAAGGGGTNAGCAATGGATTTCAGCAAACAGAAAACAAAACAAA
Sequence Type mRNA
Unitrap ID UNI25472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45926257..45927235 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es