Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA437
Clone ID YHA437
Vector pGT0pfs
Project baygenomics

Sequence tag YHA437
Sequence
GCAGTTGTTTTGTCTACTTTTACTACAGTACCTTGTCTCTGTTTGTTAGGACCAAACCTCAAAGCATGGCTGAGAGTTTT
CAGTAGAAATG
Sequence Type mRNA
Unitrap ID UNI6777

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87419742..87419832 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024145 (Pigf) NM_008838 phosphatidylinositol glycan anchor biosynthesis, class F Gene [Source:MGI (curated);Acc:Pigf-001]

 
Come back to gene ENSMUSG00000024145


For any suggestions or comments, please send an email to unitrap@crg.es