Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA365
Clone ID YHA365
Vector pGT0pfs
Project baygenomics

Sequence tag YHA365
Sequence
AGGACCCATGGGCCGTGGAGGCTATGGAGGAGGTGGCAGTGGTGGTGGTGGCCGGGGAGGATTCCCCAGTGGAGGTGGTG
GAGGTGGAGGACAGCAACGAGCTGGAGACTGGAAGTGTCCTAATCC
Sequence Type mRNA
Unitrap ID UNI6778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135123635..135123760 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030795 (Fus) NM_139149 fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI (curated);Acc:Fus-007]

 
Come back to gene ENSMUSG00000030795


For any suggestions or comments, please send an email to unitrap@crg.es