Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181948
Clone ID OST181948
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181948
Sequence
GACTGAGGGAAGTGCCAGTGAAGCCACCTTGGTGGCCCTACTGGCTGCTCGGACTAANGTTATCCGCCTGCTGCAGGCAG
CCTCCCCAGCGTTCACACAAGCTGCTATCATGGAAAAGCTGGTTGCTTACACATCTGATCAGGGA
Sequence Type mRNA
Unitrap ID UNI14679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11764896..11765038 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es