Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA408
Clone ID YHA408
Vector pGT0pfs
Project baygenomics

Sequence tag YHA408
Sequence
CGGAGAAGGGGGTCGGAGGCCCCTTCCCGGTCCCTGCACCATGAGCTGGGGCACTGAGCTCTGGGATCAGTTTGACAACT
TGGAAAAACATACACAGTGGGGAATCGATATTCTTGAGAAATACATCAAGTTTGTCAAGGAGAGGACGGAGATTGAGCTC
AGCTATGCCAAGCAACT
Sequence Type mRNA
Unitrap ID UNI6780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30960765..30997362 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es