Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181886
Clone ID OST181886
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181886
Sequence
TGGAAAGGACATGAAGGAGAGAGCCCTGATTTGCCATGTATACAGAAGGTATTTTANATCTGACTGAAATGATTGGGCAA
TTGGTATTATGTCCCCCAGACCAAAGAGAAGCCAAGACTGCCTTGGCAAAANACAGGACCAAAAACCGTTACTTGCCTGC
CTTTGAAAAGGTGTTGAANAGCCATGGACAAGACTACCTTGTGGNCAACAGGCTGACCAGGGGGGACGTCCACCTGCTGG
AACTTCTTCTCTATGTTGAA
Sequence Type mRNA
Unitrap ID UNI22811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78179936..78185392 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057933 (Gsta2) NM_008182 glutathione S-transferase, alpha 2 (Yc2) Gene [Source:MGI (curated);Acc:Gsta2-001]

 
Come back to gene ENSMUSG00000057933


For any suggestions or comments, please send an email to unitrap@crg.es