Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181850
Clone ID OST181850
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181850
Sequence
GAGACTGAGGGTTATTNTGCGCTTTGNTGCCAGGGACNACGCANCTGCGCGCCCTGCACTNTGACNAGTTTGNGTGTAGG
TCCNACNNGCTCCGTGACTANCTGCCTGATGTCCNAGCTGTGCNGCTGAAAGCCCNNAGAACTGANGCGNCGACCACAGG
TTTTAGTATAAAGGCAGTGCCATTCCAGAATGCCGTTTTGAATGTAAAAGAACTTGGAGGAGCTGACAATATCCGGAAAT
ACTGGAGCCGCTACTACCAAGGATCTCAAGGGGTCATATTCGTATTAGACAGTGCCTCTTCAGAGGATGACTTAGAAACT
GCTAGGAACGAACTGCACTCCGCTCTCCAGCACCCACAGCTATGCACTTTACCCTTTTTGATATTGGCCAATCATCAAGA
CAAGCCAGCAGCTCGCTCAGTACAAGAGATCAAAAAGTATTTTGAACTTGAACCACTGGCCCGTGGAAAGCGCTGGATCC
TGCAGCCCTGCTCTNTGGATGATGTGGACACACTGAAGGACAGCTTCTCCCNGCTCATAAACTTGTTAGAA
Sequence Type mRNA
Unitrap ID UNI12489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114724270..114945034 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es